Articles From Jean-Michel Claverie
Filter Results
Article / Updated 07-20-2022
With bioinformatics you can explore molecular biology using information technology. The links to the Web sites in the following list focus on protein sequences. Some offer searchable databases, others help you investigate a single protein; all are helpful: BLAST: Database homology search SRS: Database search Entrez: Database search InterProScan: Find protein domains ExPASy: Analyze a protein ClustalW: Multiple sequence alignment T-Coffee: Evaluate multiple alignment Jalview: Multiple alignment editor PSIPRED: Secondary structure prediction Cn3D: Display and spin 3-D structures
View ArticleArticle / Updated 07-20-2022
The bioinformatics Web sites in the following list offer help in analyzing DNA and RNA sequences. And, in the marriage of information technology and molecular biology that is bioinformatics, this type of analysis is what it's all about. Webcutter: Restriction map GenomeScan: Gene discovery blastn, tblastn, blastx: Database search The Genome Browser: Browse the ultimate data! Mfold: RNA structure prediction
View ArticleCheat Sheet / Updated 04-12-2022
Bioinformatics is the marriage of molecular biology and information technology. Websites direct you to basic bioinformatics data and get down to specifics in helping you analyze DNA/RNA and protein sequences. All of this data comes at you in several formats, so becoming familiar with various format types helps you know how to interpret and store the data.
View Cheat SheetArticle / Updated 03-26-2016
When you're using the Internet to help with your bioinformatics project, you come across data in all sorts of different formats. The following table can help you understand common bioinformatics formats and what you can and cannot do with them. Format Name Description RAW Sequence format that doesn't contain any header. Spaces and numbers are usually tolerated. FASTA This is the default format. Sequence format that contains a header line and the sequence: >name AGCTGTGTGGGTTGGTGGGTT PIR Sequence format that's similar to FASTA but less common MSF Multiple sequence alignment format CLUSTAL Multiple sequence alignment format (works with T-Coffee) TXT Text format GIF, JPEG, PNG, PDF Graphic formats. Do not use them to store important information.
View ArticleArticle / Updated 03-26-2016
Bioinformatics combines information technology and molecular biology, so it makes sense that the Internet is the main arena for pursuing bioinformatics information. The following list offers links to helpful Web sites around the world and the areas that they specialize in: Ensembl: The Human Genome GenBank/DDBJ/EMBL: Nucleotide sequence PubMed: Literature references Swiss Institiute of Bioinformatics: Annotated protein sequences InterProScan: Protein domains OMIM: Genetic diseases GenomeNet: Metabolic pathways
View Article