General Information Technology Articles

Article / Updated 07-20-2022

With bioinformatics you can explore molecular biology using information technology. The links to the Web sites in the following list focus on protein sequences. Some offer searchable databases, others help you investigate a single protein; all are helpful: BLAST: Database homology search SRS: Database search Entrez: Database search InterProScan: Find protein domains ExPASy: Analyze a protein ClustalW: Multiple sequence alignment T-Coffee: Evaluate multiple alignment Jalview: Multiple alignment editor PSIPRED: Secondary structure prediction Cn3D: Display and spin 3-D structures

Article / Updated 07-20-2022

The bioinformatics Web sites in the following list offer help in analyzing DNA and RNA sequences. And, in the marriage of information technology and molecular biology that is bioinformatics, this type of analysis is what it's all about. Webcutter: Restriction map GenomeScan: Gene discovery blastn, tblastn, blastx: Database search The Genome Browser: Browse the ultimate data! Mfold: RNA structure prediction

Cheat Sheet / Updated 04-12-2022

Bioinformatics is the marriage of molecular biology and information technology. Websites direct you to basic bioinformatics data and get down to specifics in helping you analyze DNA/RNA and protein sequences. All of this data comes at you in several formats, so becoming familiar with various format types helps you know how to interpret and store the data.

Cheat Sheet / Updated 03-25-2022

A geographic information system (GIS) is a fun and functional piece of equipment that offers maps, and so much more! You can analyze terrain and compare maps, keeping in mind the fact that the map you see is basically a model of the terrain. A grid-based GIS offers some algebraic functions to help you fine-tune a search, and every GIS provides a variety of outputs from maps to charts to 3D diagrams.

Cheat Sheet / Updated 03-14-2022

Virtualization saves money, energy, and space. After you’ve decided to go virtual, take steps to make implementation easier. Get to know some important terms about virtualization, types of virtualization, and leading companies and products in virtualization.

Cheat Sheet / Updated 02-23-2022

When planning and implementing your IT architecture, ease the process by reviewing critical information: major IT architecture concepts such as common tasks, standardizing technology, and consolidating and centralizing technology resources; collaboration solutions to institute across the enterprise; and system maintenance processes that can be automated to help you increase savings and reduce administrative overhead.

Article / Updated 03-26-2016

When you're using the Internet to help with your bioinformatics project, you come across data in all sorts of different formats. The following table can help you understand common bioinformatics formats and what you can and cannot do with them. Format Name Description RAW Sequence format that doesn't contain any header. Spaces and numbers are usually tolerated. FASTA This is the default format. Sequence format that contains a header line and the sequence: >name AGCTGTGTGGGTTGGTGGGTT PIR Sequence format that's similar to FASTA but less common MSF Multiple sequence alignment format CLUSTAL Multiple sequence alignment format (works with T-Coffee) TXT Text format GIF, JPEG, PNG, PDF Graphic formats. Do not use them to store important information.

Article / Updated 03-26-2016

Bioinformatics combines information technology and molecular biology, so it makes sense that the Internet is the main arena for pursuing bioinformatics information. The following list offers links to helpful Web sites around the world and the areas that they specialize in: Ensembl: The Human Genome GenBank/DDBJ/EMBL: Nucleotide sequence PubMed: Literature references Swiss Institiute of Bioinformatics: Annotated protein sequences InterProScan: Protein domains OMIM: Genetic diseases GenomeNet: Metabolic pathways

Article / Updated 03-26-2016

After you’ve evaluated virtualization and want to move forward with it, it’s time to implement a virtualization plan. Don’t jump right in, the first steps are to create a virtualization project using these five steps: Evaluate your current server workloads. Determine whether virtualization can help you and figure out what your potential virtualization use cases might be. Define your system architecture. What form of virtualization will you use, and what kind of use case do you need to support? Select your virtualization software and hosting hardware. Carefully evaluate the virtualization software’s capabilities to ensure that it supports your use cases. Be sure to look at the new virtualization-enabled hardware systems. Migrate your existing servers to the new virtualization environment. Decide whether some of the new migration products can help you move your systems or if you need to move them manually — in either case, create a project plan to ensure everything is covered Administer your virtualized environment. Decide whether the virtualization product management tools are sufficient for your needs or whether you should look to more general system management tools to monitor your environment.

Article / Updated 03-26-2016

If you’re trying to decide if virtualization is right for your organization, whether from an economic or technological standpoint, consider these reasons for taking the virtualization plunge: It saves money: Virtualization reduces the number of servers you have to run, which means savings on hardware costs and also on the total amount of energy needed to run hardware and provide cooling. It’s good for the environment: Virtualization is a green technology through and through. Energy savings brought on by widespread adoption of virtualization technologies would negate the need to build so many power plants and would thus conserve our earth’s energy resources. It reduces system administration work: With virtualization in place, system administrators would not have to support so many machines and could then move from firefighting to more strategic administration tasks. It gets better use from hardware: Virtualization enables higher utilization rates of hardware because each server supports enough virtual machines to increase its utilization from the typical 15% to as much as 80%. It makes software installation easier: With software vendors tending more and more towards delivering their products preinstalled in virtual machines (also known as virtual appliances), much of the traditional installation and configuration work associated with software will disappear.